Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1481
Contig Information
Length 908 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc1e16    rwhsc1e16    rwhsc1n19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05843 [Oryza sativa Indica Group]
Score 725
Evalue 1.05787e-74
Total Hit Count 162
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1481
CGAAAGGTGCAAAACAACGCAAGCTATGCAAGCATTCTAGACATAGTCATGCCACAGCACACATAGTACAGAGCTTGATGGTTTACAGCGTTACAAAACA
TCGCTAAAACAGAGTTTCGACAGCAGAGGCTGGCCATCATAACCAAATATACATGATAAATAAGATGACATTGATGCTACTATGATCTTATTGTCTTCAC
TACTAACGACTTGATTTCACATACTATCATCTGCGACGAAATTAACATGATGTTTTGCCCTTACGTCGCCTGGTCGCAGATCCAGATAAGAAGACTCGTC
ACTCCTCAGCGTAAAACTTGGGAGAGAAATACCCTGGACATAAGATACTCCTCAAAATGTGAAGTCTCCACAAAGCAGGATATGTAAATATTGATCACAC
GAACATGGCTAGCTCTGGACGGCTGAAGATATTGTCTCCATCATCGCCCAGTGCAGGATAAGAAGCAACAAGTGCATCTTGTGCACCAATATACAGAGAG
TTATAGATCTTCCAATATACTTCACGTACTTTCCTTGCTGGATGGAAAAGGCCTTGGAGGCAATAATTCAGAACCACAGCTGCACCTAGAGCAACTCGCA
TCCCCTCAATAGCCTCCATGACGGCATTTATAACATGGGGAGATGTCTCGAATATGTTGGGCCAGATATAGTTAAGCAAATGGACAAGAGCATCCTCACA
ACCCAAGCCAGCAACTCCCAGAGCCATATGCTTAACAGCAGATGCAGCAGTCTGCCTGTGAACCAGGTCCCTGTCCATTAGGGCATCTTCGAGCAAGGGA
GTAACAGCATATATGTAATCTTTGCCCCATCTCACCCAATATACTCAAAGAGGNAAGAGAGAGACTTCNAAACACCATTCTGAACATTTTANCTCCGGNA
ACTCGGTA
page-top