Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1466
Contig Information
Length 785 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc17k14    whsc9i03    rwhsc7m21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit truncated cobalamin synthesis CobW domain-containing protein [Streptomyces sviceus ATCC 29083] >gi|197713784|gb|EDY57818.1| truncated cobalamin synthesis CobW domain-containing protein [Streptomyces sviceus ATCC 29083]
Score 96
Evalue 0.0708831
Total Hit Count 148
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1466
CCCGCACCTGTCTATCGACCCAATCTCACATCAACCGACGCCTCGTCCTCCTCTCCAGATCAGATCCCTGCCCGAGCTGGTAGCAGCAACCAACTGTTCT
GCTGCTGCAGCCTTCTTCGCCGCCAAAAGGAAAAGATGCTCTATGAAATCCACTCCCATGCCCAAATCCAAGACCTGCAGGCCCGCTCCGATGAGCTGGG
CCACTCCAATGAGCACATGGATGTGAAGCTTGTCTCTCTGGAGTCGGTGCGCATAGCGCGCGAGTCGTATGCACTCCTCTGGCCGCTGACCAAGGAGCCG
ATGTCCTGGGCATGCCTGGAGCTGGATTCCCTCTCGGTCGTGGCAACCTTGTCGCTGGAAATCCAAAAGCTCGAGCATGATGTGTTACCCCAGCTCATGG
TTCAGGAGTCCAAGCTGGAACGGGGCGCCCTGGAAGCCCTCCTAGTCATGCAGAACTCAGCAATTAAGCTCTTACATCTGGCGAAGTGCTTTAAGGAATC
CTTGGGCGTATTGAAGGAGGATCTAGTCTCAGCCCAAGTCAAAGATCTGAGCATAGTGCTAAACGATATTGTTGTTCATGTACTCGAAGGTAATTGCTAC
GGTGCCTGGCTTCAGGCGCGTCTCCCGGTGCTGATCCAGCTGGTCACCGATGTGTTGGAGACCCCGGTTCGTTTCTGTGATCCTGATGAGTGCTCTGATG
AGTAGACTTATCAGCCAGCTCGAGGCTGTTGTGATGAGTATTTCTTAGGGGCGTGGCAAACAGTTTAGAATCAACCCTTTATGTT
page-top