Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1436
Contig Information
Length 394 bp
Tissue Shoot grown with cold treatment
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsc1b16    whsc12o13    rwhsc1b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01814 [Oryza sativa Indica Group] (no hit)
Score 575
Evalue 9.33833e-58
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1436
GGCGGCCAGCGTGGTGGCGGTGACTCCGGCGGCCAGTGGAGGAACTGAGCGGCGGGGCCCTCCAGTTATCGATCTATCTACCATCTCGTCGTCTTCGTCA
GCAAGTTATCTTCAGTTCCTGTGTCAGTCAGTCTGAGTCGTCGTGTGTGTCGTTGAGTCCTGTGGTGTTTTTGATCGCGAGCTCGAGTGTCGCTCTGTCC
GGGGTTAATTAGAGCTGGTTACGCGAGGAAGAAACAACATGTGTTACTATCTTTCAGTCGGTCGGTCGGTCGGTCAGTCGGTGATGCAGCAATCCCCTTC
TGTCATGGATTGGGATGTGATGTTGGAATATCCTATGTTTGAACTCGGTTTAAATGGAAGAAAATGCAAGTCGTCATAGCTGCGAAAAAAAAAA
page-top