Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1406
Contig Information
Length 639 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsc20b24    rwhsc9a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lipid transfer protein precursor [Triticum aestivum] >gi|54111986|gb|AAV28706.1| lipid transfer protein [Triticum aestivum] >gi|84617225|emb|CAH69208.1| type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 466
Evalue 5.8395e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1406
TACAAAGTACAACAAACTCCCGTGTCTGCTCAAAGGGAGTGAACGAACAATCAAACGCTGATACAAAATAGATACAACAGTGGCCAGCTATGCAAAGCTG
GCTCGATGTACGTACTCCTATCTCTCACATGGAGATCATATCAGAGCATTTATTCATGTATATGTATATATGTGTGTGTGAGACCTCAACGTACTCAGCA
TCAATCGCTGGAACTATAATCGGCGATGATGGCGGCCAGAAATCGATCAGTGGATCTTAGAGCAGTCCACGGATGCGCTGATCGTGTAGGGGACGCTGAC
GCCGCACTTGGAGGGAATGCCTGCGGCCTTGTTGGGGTTGAGCCCTCCGGCAACACTCTTGAGGCACCTGCATGTAGCTTGCTTGTCGGCGGTGCTCCGC
GCTAAGCCGGCCAATTTCCTGACGCCGCTGCAGCAGGCCCCAGACGGGCTGGTCCCGCTGCCCTTCGCATAGGCGACGCAGGGGGTCAAGGCAGAGCTCA
CCTGGCCGCAGCTGATGGCCGCGTCGGAGGCTGCGAGGATCATTGCCGCCACCAGGGCGACCAGCACGAGTTTAGTAGCTGCAGTGCGAGCCATCTCGAC
CGAGTTANCTGTAGTTGTGGACCTTGTGGTGGTGGGCTA
page-top