Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1339
Contig Information
Length 666 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1e10    whsc5b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin family protein, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 735
Evalue 4.04374e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1339
ATTCGGCACGAGGGTTCAGTTGCGTTCGCTCGATTGATCCAAAAAAAAAGTTGCGTTCGCTCGATCGAGCAGCGGGGAAACACGCCATGGAGAGCTCGCC
GCCCACAATCACCGTCCAGGTGAAGTTCGCCGGCCGAACCATTCCGGTGGAACTCCCGACATCCGCCTCCACCGCGGAGCTGAAGCTCCTCCTACAGCCG
CTAACCAACGTTCTCCCCCGCGGCCAGAAACTCATCTGCAAAGGAAAAGTTCTTGCCGACGCCGCGAGTCTGAGCTCGATGCAGGTGGGGGACGGATCCA
AGGTCATGCTCATCGCTTCGCAGGGTCTTCATCAAGGGGAAGGCCCCATCACTAAGAATAGCAGTGGTCTTGCACCAAGTGCAAAAAGAACCTCAAATGT
TAAGGATAATCAAACACTAAAACCGGAGATTATCAGCAAAAGCCGAGCGGAGCGTTGGAAAATAACAGGTGTCATTGCTTTATCTGGTTCCAGCTTGAAG
GCTGTGCCTGAGGAAGTCTGGGACTGTGGCTCCTCCATACGAGTACTAGATGTCTGTAACAACTCAATTGAAGCAATTCCACAGAAAATTGCTGCCCTTA
AATCATTAAATAAATTGTTGCTAACCGCCAATGACATATCTGATGGGGGCATCANCTGGGAAGGTC
page-top