Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1338
Contig Information
Length 497 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1f02    rwhsc1f02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit P450 monooxygenase [Hordeum vulgare subsp. vulgare]
Score 612
Evalue 3.42915e-62
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1338
CGAAAAACATACAAGGAGATAGAGATTGAAAGCATCACCTACCCTGCCGGTGTGATCATCGAGCTTCCTGTGCTGCTTATCCACCATGACCCAGACATAT
GGGGAAGCGATGTGCATGAGTTCAAGCCAGAAAGGTTTGCTGATGGGATCGCCAAGGCATCCAAGGATCCTGGTGCCTTCCTCCCATTTGGTTGGGGTCC
ACGGATCTGCATCGGTCAGAATTTTGCTCTGCTTGAGGCCAAGATGGCTTTGTGCATGATCCTTCAACATTTCGAATTCGACCTTGGCCCGACGTATTCT
CATATGCTGCATAACCAGAAAATGTTGCGCCCCATGCATGGTGCACAAATTAAGCTCAGGGCAATATGACGGTCAGTATTATAGCAGTGTGCATGATGTC
ATTTTATTACATAGTGTTTAGTGGTTGGCCATGTAATAAGCTTTCATACCTACAAATGTTTGAAATAAAGTCCAACCATGTTGCACATAAAAAAAAA
page-top