Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1337
Contig Information
Length 407 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1f03    rwhsc1f03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195620520|gb|ACG32090.1| pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit [Zea mays]
Score 280
Evalue 1.02092e-23
Total Hit Count 127
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1337
CAGTGATCAAGAAGGCTATGGTGGAACTTGATGCTGCGCCATTTAAGAAGTTTGCCTCGCTGCGAGATGAATGGGCCAGCAAGAACCGATACATCAGCCC
TGGTCCCATCCAGTTCAGCGGCCCTGGAAGCGATGCGTCGAACCATACCTTGATGTTGGAGCTTGGCGCTGAGATATAGAGGCGGCGGTGTAGAGTGTAT
TTCTTTCAAATTTTCTACTTCTTCCTTGCAGTTTTGAGAGTGGAGAACAAACTCCCATAGCGGAGCGGCAGTCTCCGCATTGTGGAATGTTTAATAAGAG
GTTGAGTTGGAGTGGGTTCAGTGGATGTCGTAATAACTAATTTTAGCTTTTTTATGACCCGATTGCTCCCCATATATCGAACCCCCGCCTACCCCTGAAA
AAAAAAA
page-top