Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig98
Contig Information
Length 1441 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14g18    rwhcs14g18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25118 [Oryza sativa Indica Group]
Score 631
Evalue 1.66474e-63
Total Hit Count 320
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig98
AAGGCGTACGGCGAGTTACAAAATAGGAGAAAAACCCAGTAATCTCGACCCAGCTGGACTTAATGACAGTGGCCTTGTGGCCAAGCTGTTGGATGTACAG
CTCAGCCTCTTGTACAATGATATATACACCAAGGCTACTTTACTTCGAACAAGGAGTGGTATTTTAGTACGTTTAATCTCTCAGTTGTCCACTGTTGTTG
CCCTTGTGATCTTTGGTGTCATGGGCAAGAAACAAGCAGCAAGCAGGTTGTATGGTAAGGCTGACATTGTCATCACCTACATCCTATTTATCGGAGGAAT
TCTTTTAGAAATTTGTGCTGTGTTTACTGTGTTGATGGCTTCACCTTGGACATGGTTGTGGCTGGAGGATCGAAGGTACGGTAGGCTGGCTAGGATTTCA
TGGTCTCTTACTAGATTATCAGTGACAAGGCCGAAATGGTCAGGAAAAATTGGGCAGTATAGCTGTGTAAACTACATGGGCATCAAAGATGAGTCAGCTA
CATTGTCCCAAAAGGTGATGAGTCTGATGAGGAAGGCGGCGACAGCAATCGGCGTTAAAGATGTAAGGAAGAAGCTGTTTTGGGTGAGCAAGCGGCTAGA
TTGCAGGTACGAGACTGTGGACAACAAGCTCATGGAGTGTGTCCTGAGGGAGATACGAACCATCATATCTGAGTATGATGAGGATGATGATGACCAACAG
CCTCGGCAGTGGCCACATATGATGCCGTTTCTGAAGAAGCTAGGATCGACATTTGTCACGGCGTTTCTCTCTGCCGTATGTCAGCTGCACATTGTCACTG
AGGTTATCTTGGCGTCGACTAGTGCAGATGACATGAAATCATACAGCGCCGACGCAATTGCGGCCGCCCAAATGTGCAAGAAGCTGTCCAACTACATGAT
GTACCTTATTACTGCCCACCCAGATGCTGCTTCTTTGCTGCAGGTCACCTCTATCATCAGTCTCGAGCTTGCTCTAGACATGCATTTAACAGCCACTGCT
ACTACATCGACTAGGAAGAAGAGCAAGGATGAAATTCTGCGTGCTACTGGAGATGATCTCAAGGCTAATTATGGCAATTATGATTGTTTTCCATGGTCAA
TGGCGCAGCGAGAGGAGGTGATCAAGGAGCTTGCCGGGATTTGGGTGAGGCTTCTCATCTACGCCGCCGGCAAGTCGAGGACGGAGCTTCACGCAGCGCA
GCTGGCCAGAGGAGGGGAGCTACTCACCTTGGTCTGGCTGCTCATGGCGCAGCATGATCTTGGGGATGTCACGTTTAATCGTGTCGAGCTAAATGGCAGG
CCTGATGATCCCGTCACAAATTTGCATGTGCTATATGCCTTCCATGTCTAGTCCAGAACTCCAGATCGTCAAGCATTGTTAGTTAGTTCCATGTATGAGC
AAATCGGATGATTTATTGAACTACTTGTTGGTAATATATTT
page-top