Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig97
Contig Information
Length 622 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15p20    rwhcs15p20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H2B.1 [Zea mays]
Score 447
Evalue 8.65699e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig97
CCTTCATCCTCCAGCGAAACCCCACCCCGCCCCACCCCACCGTCAGCATCCATGGCGCCCAAGGCCGAGAAGAAGCCGGCGGCGAAGAAGCCAGTGGAGG
AGGAGCCCGCGGCGGAGAAGGCCGAGAAGACCCCGGCCGGGAAGAAGCCCAAGGCCGAGAAGCGGCTGCCGGCGGGCAAGTCGTCGGCGGCGGCCAAGGA
GGGCGGCAAGGCGAAGAAGAAGGCCAAGAAGAGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCCGACATCGGCATCTCC
TCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGCGAGGCCGCTAAGCTGGCGAGGTACAACAAGAAGCCCACCA
TCACGTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCTGTCACCAAGTTCAC
CTCCTCCTGAGTCTCGTAGTTAGCTGTTTGGGTGTGTTTGTGGCCGTGTTATCGTGTAAGAATCGCATCGCTATGTTTCTGGATCTCGAGAAATAGTAAC
GGTGCCTGCCTCAAAAAAAAAA
page-top