Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig96
Contig Information
Length 918 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15p18    rwhcs15p18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20132 [Oryza sativa Indica Group]
Score 942
Evalue 5.18508e-103
Total Hit Count 138
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig96
TATCCTTGTTCATAAGGTTATTCTAGTTTCACTGGAAAATGGGGTTAGAGAAGGCCAGAAATTCGGTGCATGATTGGCTGGCTATCCTTATAACTCGGTA
TAATGATGCGTTGAGATCTGATCCACGAACACCAGAATCGCACATTGATATAGACTTCTCACAATGCCCCCATCTGCAAATGATACCCCAGTTTGTGTTT
GGAATGTTGAGGAGCCCTCTTCTTCGCTTGCATGAAGAAGGCATCCACCCAGATTACAGGATATATCTTCAATGCCTTTTCAGCTCACTGGAGCCATCTT
CTCTAGCCAAAGCTATATATCCACTTTTAATTTCGTACTCCTCACCTAATAAGCAAGCATTCCCACGGCACACTCTGAGCCGTGCTGCTCTGACGATGAG
TGAGAGCCCGATATTTCTTCTGGATGCGTTTACCAACCTTGTTGTTTACTATTCATCGACTGCTGATCCTTCGCTTCCTTTTCCTCCACCCCATGACTGT
CTTTTGAGAACAACGATTAATGCGTTGAAGCAGGACAGGTGTATCACACCTAAGCTTGCAATTGTTCGTGGGGGACAGGACGATTCATCGTTGTTTGAGA
ACTATCTAATTGAAGAGCAAGATGTTGATGGTTCCGGGTATACTAGTGGTAATGGTTTTATATCATTCCGCGAGGGTATCAGGAATGAGGTAGCAGAGAT
CCTCAAGGAAGAAAGTGGCAGCTAGGTCCTGACCGCTATGGGCTTGTGGTTCCGAAGATGGTGTAGATTGTGTCGACAGCTCTTTCTTTAACATTATGGC
GTAGACTATTTAACTTTACTCGTCTAAAATTGATAGAGATATAGTCAATGGAGTAATAAAGGGCGAAGGTGTATTTGAATATTACAAGTAGCTGCTTGTG
ACAATAGCTCAATGTGTA
page-top