Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig95
Contig Information
Length 621 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14g19    rwhcs14g19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit transaldolase 2 [Oryza sativa (indica cultivar-group)]
Score 555
Evalue 2.56122e-55
Total Hit Count 253
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig95
GAAATTCTCTGGCCCGAGGTGGGAGGCTTTGGTGAAGAAGGGAGCCAAGAAGCAGAGGTTGTTGTGGGCATCTACCAGCGTGAAGAACCCGGCTTACTTG
GACACTCTTTACGTCGATCCTCTCATCGGACCTGACACCGTCTCTACGATGCCCGACCAAGCTCTGGACGCGTTCATCGACCACGGCACAGTTGCTAGGA
CAATCGACGCGAACGTATCAGAAGCCGAGGGCATATACAGTGCCCTGGAGAAGCTGGGCATCGACTGGGAAGAGGTTGGCAAGCAGCTGGAGCACGAGGG
CGTGAGCTCCTTCAAGGGGAGCTTCGACAGCCTGCTCACGAGCTTGGAGGAGAAGGGCAACGCCCTCAAGACCGCCGCCAACCTGTAGGCGCTAAAATTG
TTGGATAGAATGGTTTGGTACCGGCGCTGGCCATCAAACGATTACCCAATAAAAATGCCAGCTTGCTGGCTCTCCCCTTCCATTCGGAAATGAAATGCTC
CCAGTTATCTGGGTGAGCTTCTTTGTATTCTAGGCGTGCCTGGCTGTCATTGTGTAAACTGAGGTTTGTTGCTCGCAACTGCTATCGTTTTCTGATCAAT
TGTTTTTGAGCAAAAAAAAAA
page-top