Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1118
Contig Information
Length 410 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1a10    rwhsc1a10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024479 [Oryza sativa (japonica cultivar-group)]
Score 241
Evalue 3.38467e-19
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1118
TCGCCGTTCGCCATCGCGACGCCCATGGGGGCGCGCTCCGCGAGGGAGATGCTGGGCCTTCCACCGGGGGGCGCTGGCGACGAGGAGTTGATCAGGCGGC
TGTTCGATGAGGACATCAACGAGATGGGCGGCGGCATCGTGCTGCGCGCGGAAGACGTTGCGAGGGCGGCAGTGTTCCTGGCGTCCGACGAGGCTAGGTA
CATCACTGGGCATAATCTCATGGTCGACGGCGGGTTCTCCGTGGGGAAGCCGCTCAATGTCCAGGCCTGTTGACTATTGAGGACGGCGAGAATGGTGCCC
GGTTTCAAGAAATTAAACACAAAATAAATCTGAAGAAAAAGAAACAGTGTACTTTGGTCTCGTTTTCAGAGCTCCGTGTGCATTCGTTCTTTTTTCAAGT
AAAAAAAAAA
page-top