Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig94
Contig Information
Length 1263 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15p16    rwhcs15p16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0398000 [Oryza sativa (japonica cultivar-group)] >gi|38347164|emb|CAE05154.2| OSJNBa0039C07.10 [Oryza sativa (japonica cultivar-group)] >gi|113564240|dbj|BAF14583.1| Os04g0398000 [Oryza sativa (japonica cultivar-group)] >gi|215715341|dbj|BAG95092.1| unnamed protein product [Oryza sativa Japonica Group]
Score 560
Evalue 2.37362e-55
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig94
ACGTTGTCCGCGCCTAGGCACCAAAGTCCAAAGCAACAGCCATAGCTCGATCTCGATCCCCGGCGCGACGAAAGAAAAAGAAGCGGCGGCAGGTCGACAG
GTCGATCAACTAAGGTGGATCCCCGGAGGCATGGGAAGAGGCCCCTACCCGCCGACGAGGAGGAGGAACAGCCGCCACCGCCGCCGTCAGCAGCCAAGCA
CGAGCAGGTGGAGGAGCAGCCGTATCACCACCTCATCGGGCGCGCTCTGCAGCAGCAAGGAGCTGCCAGCGCCGGCGGAAGCTCGGGAGCAGATGTGGCC
GACCCTTCCCCGTCACCGGAGGCGTACGCGCAGTACTACTACTCGGCGCGCGCCGACCACGACGCCACCGCCATGGTCTCCGCTCTGTCCCACGTCATCC
GCGCCACACCGGACCAGCAACAAGCCTACTACCCCGCCGGATCCGCCGCTGTCTCAGGAGAACAGCAGCATCAGCACGATGCGGCGGCTGCCGCGGCCAT
CGCTGAGGAACAAGGGAGGAAGCGGCACTACAGAGGGGTGAGGCAGCGGCCATGGGGAAAGTGGGCGGCGGAGATCCGGGACCCCAAGAAAGCGGCTCGT
GTGTGGCTCGGCACCTTTGACACGGCTGAGGACGCCGCCATCGCCTACGACGAAGCGGCGCTGCGCTTCAAGGGCACCAAGGCCAAGCTCAACTTCCCCG
AGCGCGTCCAGGGACGCACCGACCTCGGCTTCGTTGTCACGCGCGGCATACCCGACAGATTGCAGCAACAACAACACTACCCCGCCACCGTGGGGGCGCC
GGCAATGCGGCCACCGCCGCACCAGCTGCAGACCGTGGTGCCGTACCCTGACCTCATGCGGTATGCACGGCTGTTGCAGGGCGCTGGCAGTGCCGGGGGC
GCTGTCAACCTGCCGTTCGGCGCCATGTCGCCCCCGTCGATGTCCTCGTCGGCGCCGCACATACTCGACTTCTCGACACAGCAGCTCATCCGAGTGAGCC
CGGCGTCTCCCGCGGCGGCAATGTCGAGCTCAGGCACAACGGGGCCGTCCACCTCATCGTCCACGACTACGGCATCGTCGCCAGGTGCTGCATGGCCGTA
CACTGGGGAGCACAAAAATAATAAAGACTCGTGAGAGATCAATGGATCGAAGGTGCTTGCGATCCATCGGGACATGTCTTAGCAGTAGATGAGGAATACG
CATGCATTCATCATGCAATAAGGTGGGTAAGTGTTGGTCAATTAATTTTGCTGGTGAACATTC
page-top