Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig93
Contig Information
Length 861 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14g24    rwhcs14g24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1153
Evalue 2.27216e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig93
GTCTTGATGGTTTGGCCTCAAGGTGTGCTGAGTACTACAAGCAGGGTGCACGCTTCGCAAAGTGGCGGACTGTTGTTAGCATCCCTTGTGGTCCTACTGC
ATTAGCTGTCAAGGAAGCGGCATGGGGACTTGCTCGCTATGCTGCTATTGCTCAGGACAATGGTTTAGTGCCAATTGTGGAGCCAGAGATCCTCCTCGAC
GGTGACCATGGCATCGAGAGAACTCTTGAGGTCGCCGAGAAGGTGTGGTCCGAGGTGTTCTTCTACCTGGCCGAAAACAATGTTCTTTTTGAGGGCATCC
TGCTGAAGCCCAGCATGGTTACCCCTGGTGCTGAGCACAAGGAGAAGGCTTCTCCAGAAGCCATTGCGAAGAACACCCTCACAATGCTGAGGAGGAGAGT
ACCGCCCGCTGTCCCTGGAATCATGTTCCTTTCTGGCGGGCAGTCCGAACTGGAGGCGACGATGAACCTGAACGCGATGAACCAGTCCGCCAACCCGTGG
CACGTGTCCTTCTCGTACGCCCGGGCCCTCCAGAACTCGGTGCTGAAGACATGGCAGGGGCAGCCCGAGAACATCGAGGCGGCGCAGAAGGCCCTGCTGG
TCCGCGCCAAGGCCAACTCGTTGGCGCAGCTCGGCAGCTACACGGGCGAGGGCGAGAGCGACGAGGCCAAGAAGGGCATGTTCCAGAAGGGCTACACCTA
CTGATGAGGCGGCGGCAGGATGATTTACATATGAGACGCACGTCATTTTGCGGGGTTTTGTTTTTTTAACTGTGGGTGTGAATAATCAATCACCAGCGTG
TTGGTGCCAACGACTGTTAGCTGTATTGGCAGCGCGGAAATTCTAGGGTTGCCTGAAGTAT
page-top