Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig91
Contig Information
Length 717 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15p13    rwhcs15p13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to chromosome 9 open reading frame 79 [Equus caballus]
Score 87
Evalue 0.653112
Total Hit Count 42
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig91
ATTCATCGCGGCCATCCATTCCACCACCATCCTCCTCCATCGACGCCTACATGCTCACCGGTGGCGCATCCTTCCTCCCTGCAGCTAAAGCAATTCCTTT
TCGTCGTTGTTCACGTATCACGACCAACCACCGCCTCCCCATCCCTCCGGCCTCGACCTGCAGCTGGGGGAGGTCTCGACCTGCAGCGCCCGGAGGTCTC
GACCAGCAGCTGGTCGCGTGCCCGCTGCATCCCCTGTCATTTCCCTCCCGACCTTCCTCTCCATCTACAATGATGAGCTCCTGTGAGCAGTGATCTGTTG
TCTGTGTCATCCTCAGCCACCCTCGAGCTTGCAAGATAGGTCACTGCCAACGCACGGGTCCGATGCATACATGCCGATGTGTAGCTGAAGAAGATCAAAC
AGAGTGAGAGCAGTCTGTGCAGGCATCTACCTCTCCTTGTTCTTTTTTAATTGTGGTGCCATCAATCCATCTGCATCGAGGCCTTACGCAACAGTTGCGT
TCAAGACTGGCTACATCCTCAGTGTCGAGGTCTCCACAGCAGGTCGAACTATGAAGAAGTAGCAGGCTAGATTGATGAAAAATAGAAGTTGTGGTCGTTG
ATTTGAGCTGACAAATGCTTGATTGCCTGCCCAGCCGTTGTGGTCACGCGCGCTATGCTGCTGCAGACTCCATGTGTAATGTTCGTGGAATACCATATTT
TGACTGGAAAAAAAAAA
page-top