Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig90
Contig Information
Length 1032 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15p01    rwhcs15p01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit derlin2-1 [Zea mays] >gi|114149269|sp|Q4G2J4|DER21_MAIZE RecName: Full=Derlin-2.1; AltName: Full=ZmDerlin2-1 >gi|64500980|gb|AAY41610.1| derlin2-1 [Zea mays]
Score 1078
Evalue 1.51477e-115
Total Hit Count 376
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig90
CCCTCCTCCCCCATCCCCGTCGTCGCTCTTCGATTCCGCCGGCGATCCGCGCCAGAGCCCATCTCCATCTCAGGTAGAGGTGAGTAGTAGAGGGAGCGGG
GAGCTAGGGTTTCCGCGCGCGCGCGTGTGTGGGAGGGGAGAGGAGGAGCAGGGATGGCGCAGGCGGTGGAGGAGTGGTACCGGCAGATGCCCATCATCAC
GCGCTCCTACCTCACCGCCGCCGTCCTCACCACCGTCGGCTGCACCCTCGAGATCATCTCGCCCTACCACCTGTACCTCAACCCCAAGCTGGTGGTGCAG
CACTACGAGATCTGGCGCCTCGTCACCAACTTCCTCTACTTCCGCAAGATGGATTTGGATTTCCTGTTCCACATGTTTTTTCTTGCGCGCTACTGCAAAC
TTCTCGAGGAGAACTCATTCAGGGGAAGAACAGCTGACTTTTTCTACATGCTCTTGTTTGGTGCTACTGTCCTGACTAGCATCGTTCTGATTGGTGGGAC
AATACCTTACATTTCTGAGACATTCGCCAGGATTCTTTTCCTCAGCAATTCATTGACGTTTATGATGGTTTATGTCTGGAGCAAGCACAATCCCTTCATT
CACATGAGCTTCTTGGGTCTGTTCACCTTCACTGCTGCCTACTTACCTTGGGTCCTTCTTGGCTTCTCTATTCTGGTGGGGAGCAGCACATGGGTTGATC
TTTTGGGTATGATTGCTGGCCATGTGTATTACTTCCTGGAAGACGTGTACCCTCGGATGACCGGTCGGCGTCCCCTGAAGACCCCTTCCTTCATCAAGGC
GCTGTTCGCCGACGACAATGTGGTCGTGGCGGCCCGCCCCCCCAACGCCGGTGTCGCGGCTGCAAGGTTCGGTGGTGTGGGTGCAGCAGACCCCCAGTTC
CAGTGATGACCGACATGCAGTTTGTTGGATATAATTTTGTACACCCGTGTCCGTGATGATATGTGCAAAATATACACAGTATAATTCTCAGTTAGGGGTT
TGGATTTGATGCCAATGCGCTGCTAACAAAAG
page-top