Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig89
Contig Information
Length 518 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14h20    rwhcs14h20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 410
Evalue 1.03696e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig89
TCCCTCTTCTTCCCAATCACACACCTGTCGGAGCTAACCGGAGCGGCGATGTCGGGGCGCGGCAAGGGCGGCAAAGGGCTGGGCAAGGGCGGCGCCAAGC
GGCACCGGAAGGTGCTCCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTGGCCAGGAGGGGCGGCGTGAAGCGCATCTCGGGGCTCAT
CTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCACCGCC
ATGGACGTCGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGGTTCCTGGGTTCCGTTGGTGGCAGCAGCAGTGTGGTTGCG
GCTGTGTCTGTCTTGTGCCCTCTGTGATGTGTGCTGTGGGAGATGGGATTTACTGCTGCTTTGGCGTGCGTCGTTGTGTTCCGTGTCTTGTGTTCAGTAG
GCTGTAATATCTGTGCGT
page-top