Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig88
Contig Information
Length 670 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15o17    whcs15o18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017787 [Oryza sativa (japonica cultivar-group)]
Score 861
Evalue 1.01319e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig88
CCGCGGAACTTGAAATATTTGCGCCATCTGGATATGGACAGGGCAAGTACGTCGAAAGTTGTGGGTATTGGGGAACTGATTCATCTCCAGGGATCAATTG
AGTTCCATGTTAAAAGGGAAAAAGGTCATACGTTGGAAGATTTGTATGATATGAATGGTCTCTGCAGAAAGCTCCATATCAAGAACCTTGATGTTGTATC
CAGTAAACAAGAGGCCAGCAAAGCTGGCCTGAGAAAGAAACAGGGTATTAAGGTGCTGGAACTAGAATGGAATTCCACTGGTAAGAGTGACCCTTCTGTC
GATGCTCAAGTGTTAGAAGGCCTTGAACCGCACCCGCATGTTGAAGAGGTCCGTATCAGAAGATATCATGGTGATAAGTCACCGTGTTGGTTGGACATGA
GCTTCAAGTTGAAGGAGGGAAGTACACCGTGCCTACTTAAATCTTTATATTTGACCAACTGTAGGAAGTGGGAGGTCCTGCCTCCTCTTGGGCAGCTTCC
CTGCCTGAAGGTTTTGCATTTGAAAGAGATGTGCTCACTGAGACAGATTGGCAGTGAGTTCTATGGAACCAAGTTGATTGCATTTCCATGTCTGGCAGAA
CTTGAATTTGATGATATGCCACAGTGGGTTGAGTGGACCAAAGAAGAGAGCATGACCAATGTTTTTCCCA
page-top