Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig1051
Contig Information
Length 841 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1d13    rwhsc1d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative chromosome condensation factor [Triticum aestivum]
Score 335
Evalue 2.58424e-55
Total Hit Count 119
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig1051
AAATAGTGAAGGCAGCACTCACAGCCTTAGAATTACCAGTCCTCACGGATCGGATCGCCCTCACCGAAGAGCCCACAGCAATAGTGATGAGATGCTGTCT
GCAAGTAGCAGAGGTGATGATAATGTCAGCATAGATGCTAGGTCCCTTCAAAATGGTGACGACAGCTACAAACCTCGAGGAACAATATCAATATCCCAGC
AACCAAGTACAGGCTGAGTGGATCGAGCAGTATGAACCAGGTGTTTACATAACTCTCACGACCCTCCGTGACGGGACTCGGGATCTGAAGAGGGTTCGCT
TCAGCCGAAGGCGCTTTGGGGAGCATCAGGCTGAAAATTGGTGGAACGAAAACCGCGAGAAAGTGTACGAGAAGTACAACGTGAGGAGCTCTGAACGGGT
CTCGTCAGCAGCCTCGACCCGGTCGGCCTATTAGCTTACCTGTGGATGACCTGTTGCACGCCGACACCTGTTTCTTCACACACAAACTGCAAGACCAATC
AACATCAGCAAATTATTAGCAAAACTGTGGTCATACAAACTGGGCTGGAGACCGCCAAATTGCGATGGCCACTGCAATTTTTATCGTCTTTTCATGCTGT
AATACCGATAGGATGATAAGTCAAGTTTTTGGTTGGTGTTGAATCCGCCTGAGGGTGTAGCATGGGCCCTGTCCCAGTGTAATGTACATACATGGACATG
ATCAAACAGGGCATGGTACCTTCACCATGTTATAGATCACACTAGCCATTGTAGCTAGGTGAAGTTTTTTTTTCTCTTCCAGTTTTTTTACCTTTTCCTC
AGTATGATTATTTTTTACAAAAGAACTTGTGTCCTGCAATG
page-top