Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig86
Contig Information
Length 865 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15o12    rwhcs15o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0151600 [Oryza sativa (japonica cultivar-group)] >gi|53791424|dbj|BAD13707.2| RadA-like protein [Oryza sativa Japonica Group] >gi|55296625|dbj|BAD69327.1| putative RadA [Oryza sativa Japonica Group] >gi|55297278|dbj|BAD69063.1| putative RadA [Oryza sativa Japonica Group] >gi|113594868|dbj|BAF18742.1| Os06g0151600 [Oryza sativa (japonica cultivar-group)] >gi|215736826|dbj|BAG95755.1| unnamed protein product [Oryza sativa Japonica Group]
Score 804
Evalue 6.73179e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig86
TTGAAATGTCAGAACACGGTCTGCAAGCTGTTCTGAATCCCAGTGAGATGTTCTTAACTGAGCATGACTCTGATTCTGAGATACTGGCTGGGCTTGCTGT
AGCTGTTGTTTTGGATGGATCCAGAACCTTCGCTATTGAAGTTCAGGCACTGTCTGTTCCTGGTTCTCCTGGTCAAGGAAAAGTTGTTGGCACACGGTCA
AAAAGGGTTGAGATGATAATATCAGTTCTTATGAAGCAGGCAGGTCTAAAACTTCATGATAATGTTATTTATCTGAATGTGGTCAGTGGGTTCGAGCTGA
CGGAGACTGCAGGAGATCTAGCCATAGCAGCTTCGATTTGCAGCAGTTTCTTGGAATTCCCTATCCCAAATGATATTGCATTTATTGGAGAGATTGGCCT
TGGTGGTGAACTTAGAACTGTGCCAAGAATGGATAAGCGGGTGATGGCTATCGCAAAGTTGGGCTACAGGAAATGCATTGTCCCCAAGACTTCGGAGAAG
CTGCTCAAACCTCTCGATCTCGATATCCAGATCTTGCCCTGCAACAACCTGAAGGAGTTCATAAACACAGTGTTCCGGTCAGAAGTATGATGTTACATCC
TGGCAGCGTGCTCTTCTTACAACTAGCTGATTGAGTGACAGTAGGTTTTTAGCGTGCCTGGGTCCATTGGTCAACCATAACTTGTTCGCTCATTTGAAGT
GCCATTTTTACACTTCAACCGATCAAATCCCCAGTCATTTTGTGCATGATCCTTTTGCTAGGAACTACGGCTCACCACTCCATGCATGCATGATGTAAAT
CTTTGTCATCCCATCCTGGTTATGTATATACTCCCTCCGTTCCTAAATATTTATCTTTCTANATA
page-top