Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig85
Contig Information
Length 775 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14i02    rwhcs14i02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00169 [Oryza sativa Indica Group]
Score 119
Evalue 0.000147863
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig85
AAGCCGTGAGGAAGCTCAAACTTGACGCAATCGCTGCTAAGCAGCTGCAGAGGGAGAGGGAGTTAGAAGAGAGGGAGAAACAGAGAAGGGAGGCTCTCCT
AAGAGGAGCAGAGCCCGTGCGCGCAGCTGATGCACCAGCTGCTGCTGCTGTCGCACCGCCAGCCCGTGAACCAGCAGCGGCAGCCCCAGCTGCAGCAGCT
GCAGCAACTGGTGCTGCTCCTAGCAAGTATGTCCCAAAGTGGAAACGTGAGGGTGATAGTAGCAGTCAGAGGCCGACTGCGGCAGCTGAACCAGACCGGT
GGGTCCGGGATGATCGTCCTCGCCCTGCCCTCCGCCAGGATGCTCCTCCTGTGCGCGATGCTCGTCCCATCCGCCAAGAAGCTCCTCCTGCACGTGATGC
GCGTCCCTTCCGCCAGGAGGCTCCTCCCGCCGCACGCCAAGAGGCGCCCCCTGCTGCCCGCCAGCCGGACGGTGCTGCTCCAGCTGCATCTACTGAACGC
TGGCGTCCTGGATCTAGGACCTCTGCAAATTCCTCATCCACCTCCTCGTCCACCGGCTGGAGGCGCTGAAGCTGCCTGGCCTGAAATGCGCTGTGCTCTG
CCCGCTGTCTGAGATTTTTGCCGTCCTACTTCCATGTCTTGGAGCTTCATGCACAATGGAAGTCTGCCACTGATATCTGGGAGCACGGTTACTTGAATTT
GCTTGTTGCGCACCTAAATTTTCGAATTGAAACCTTGCACTGTTTCTCAGTCATGTTTGATGTTTTGAGAGTCAC
page-top