Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig82
Contig Information
Length 517 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14i18    rwhcs14i18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20678 [Oryza sativa Indica Group]
Score 281
Evalue 9.42252e-24
Total Hit Count 225
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig82
GATATTGGAAGACAGGTTCTGACTTATGGGCAAAGGAAGCCCGTTGAGTACTTTGTGAGAGCTGTTGAGGCGACCACCCTGAACGACATCTCTACGGTTG
CACAGAAGATAATCTCTTCACCGCTTACATTGGCATCATGGGGCGATGTTATCCACGTCCCGAGCTACGAGTCCGTCAGCCGGAAGTTCCTCTCCAAGTG
ATGGTTCATCGGTCGGCACCTGGACAGACCTGTGGAGTTCGTTCCGAAGTTTCAAGCCTTAGCCCTGCACCGGCCCTCGGCTGGAATAAAACCAGTGATG
CTATATTTTTGTTGACTAGTTATTACAGCGATGGATAATCATAAGGTTTCTGTCATCTGGTGTGTGCTCTACCGTGCAGCTACACTAGGGTCGTCCCTAA
ATCAGGCGACGTCGGGTGGTGTTTTAGTTGAGAGACCTGTACCACTCTGCTTGTATGATCCATCTATATGTTCATTTTGGGTTTATGACATATGAATGCC
CTCCTGTAAAAAAAAAA
page-top