Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig81
Contig Information
Length 597 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14i19    rwhcs14i19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit wali6 >gi|1090844|prf||2019486A wali6 gene
Score 414
Evalue 5.31022e-39
Total Hit Count 70
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig81
CCTCGTGCCGCATTAGACAGGACAAGCCAATTGCTTTGCTCGACAAGTGTAGAAGCAACGATGAAGAGTAGCACGCTCGTGGCGATCCTGATTCTCCAGG
CCGTCCTGGTCATGGGAATCCTCTCACAGGCGAACGCCGAGTTCCCAAAATGCTGCGACAACTGCAGGTTCTTCTCGGGGGCCGTGGTCTGCGACGACGC
CGGCCCCAAGTGCCGCGACGGCTGCGTGAACTGCCGCGTCGTGGAGACGAGCCCCAAGATGACGTTCCGGTGCGCCGATGCGCGCGGCGACGACGGCACG
CCCTGCCCGCCCTGCAAGAAGTACTGATCGCGCATGCTCGGAACATAAGATGTTGCGCCGAAAAAACTCGGATGGGTTGAGCAGAGCCGTTGTGGTTGTA
CGTGCACGTGGTCCACGCCCAACAACAATTGTTGTTGTTGTCCTCGTCGTTATCTTTTCTTCTTCTTCAGAAAAAACCTGTTTTTTTTTGCGAATAGAAA
AACCTGTTGTTGCTCCGTGAATAAGCACTTGTATCAATTTATGCCTCTCTGCTCAATCAAATAAAATATTTGTTTATTTGTGTCAATAAAAAAAAAA
page-top