Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig80
Contig Information
Length 797 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14l11    rwhcs14l11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit early nodulin protein [Brachypodium sylvaticum]
Score 286
Evalue 6.79275e-24
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig80
CGCTCACTACTACTGCTGATACTTCACTGCTACTACCAGTTCACTTCCTTGGGATCTCGGCCAACATGTCGACGGTGACCCGCGCCTACCTCGACCAGAG
GCTCGCCGCCGCCAACCGCTGCTCCAGAGGTACTAACCAACGACGACTGGTTCCGGCCTCAGCCCAGCACTGCTCGTATATCCAATTCATTGCAGCTTAT
GTGTCTGCTGAAACTGATCTTGATTAACATTCCTATGTTGATCCGAAACTGCAGAGGCTGCCATGGCCGGAGCCAAGGCCGCGGCAGTCGCCGCCGTCGC
TGCCGCAGTCCCCACCGTAAGTACACGTTTCTCGGCTGGCGCCGCTATCTTGCAAGCATCCCCAAGATACAACAATCATGCATCTCACTGTCTTCTTCCC
CCGTGCCTTTCTCTGCAGCTAGCGAGCGTGAGGATGCTGCCGTGGGCGAGGGCGCACCTCAACCCGACCGGGCAGGCGCTCATCATCTCCACCGTCGCCG
GGATGGCCTACTTCATCGTCGCCGACAAGACCATCCTCTCCATGGCCAGAAAGCACTCCTTCGAGGACGCGCCGGACCACCTCAAGAACACCTCCTTCAA
CTAATTAGGCTATAATCTGCACGCCGGCCTGGAAGTATTATAATGTTCAGCACTTATTCGAGATCAGGCGAGCCTTGCAGACAGTCAGTGGTGTAGTATT
GCGCTTCGCTGCGTGCAACTTATCTGATGAAGTAATCATCATGTATCCAGCCAGTAATCTTGAATTAATAATGACTTGTATTTGTACAAAAAAAAAA
page-top