Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig79
Contig Information
Length 657 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15n10    rwhcs15n10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09391 [Oryza sativa Indica Group]
Score 569
Evalue 7.01345e-57
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig79
AGCATCATCATCAGCAAGCATCAAGCAAAGGCAGTTTGGTAGTACTAGCTAGCCCGTGTTAGTTAGCCAACTAGCAATCTCGCATCAACATCCACATATT
GATCGACCATGCCGTCGATTGACAAGGCCACCGACAACGGCGAGCTGAAGCAGAGGCGGCCGGAGCTGGAGCTGGTCTGCGTCACGGGCGCGGGAGGCTT
CATCGGCTCGTGGGTGGTGAAGGAGCTCCTCCTCCGCGGCTACCGCGTCAGGGGAACCGCCAGGGACCCCGCTGACCAAAAGAACGCGCACCTGTTGGCG
CTGGAGGGCGCCGAGGAGAGGCTCACCCTGTGCCGCGCCGACGTCCTCGACTACGACGGCCTCCGCGCCGCCTTCCGCGGCTGCCGCGGGGTCTTCCACG
TTGCCTCCCCCGTCTCCAACATCCCCGACCTCGTGCCGGTCGCCGTGGAGGGGACGAGGAACGTGATCAGAGCGGCGGCGGACGTGGGCGTGCGGCGGGT
GGTGTTCACGTCGTCCTACGGCGCCGTGCACATGGACCCCAACCACAGGCCCGACGCAGTGCTCCACGAGACGTACTGGAGCGATTATTTTTTTTGAAAC
AAGGCAAAAGACTTGCCATTTTCATTGAATAAGAAGAATGTTTTAGAGTCGAGGCCA
page-top