Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig77
Contig Information
Length 856 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14j05    whcs1i09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chitin-inducible gibberellin-responsive protein 2, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 544
Evalue 9.35786e-54
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig77
TTTCCTTCCCCTCCTCCCCCTCCTCTCCCCGCCTGCTCCGTCCATCCCCCCTATCTCCTCCCCGCCTCCTTCCAGCTCTTGTACTACTCGGAGCGCCTCC
ACCCCCGACCCCGACCGCCCAACCACCTGCCTCTTGCTTCTCCCGCTGTCCGGGCCAAGAATCCGAGATCCTCCCCGGCGCCGCCGCCTGTTTCTTCATG
GCCGCATAGATGGCAGGATCAACTTCATTTTGAGCTTGTCCCACAAGGTTGCAATCACCAGTATGTCAGCTAAGGCTTCAGAACGTACGTATAGATGCTC
AGATGATTCACAAATGGCGTACTACAACAACTCGGTGCCTTTAGCAGAAAATGGACGGTTCTATATGATGCAAAATCATCTGGATGTTCACTACACATCT
TCAGGTGATGGGTCACAGAAAATTAGTTCCAATCCTCAAGTATTTGAAGCACAGTACTGCACACTCGAATCATCATCGGCAAATGGTGTTTATCCTACAC
AGAGCTCCACATCTTCTCATAGCATCTCCCCTATAAGTGGGAGCCCCCTGTCTCAGAATGATAGCCACTCATACCACACATATGATTCACCCCCAACTGC
TTCATGTGTTACCGAGATACCGGATTTCCAGAGTAAACTAAAGGAGCTAGAAAATGCAATTCTTGGACCTGAATTGGACATAGCCTTTGACAGCCCCGAG
AGCTTATTGCAAGCCAACCATCCTTTGAAACAAGATAACTGGAGACAGCTTCTGGGGAATTAACACAGGAGACTTGAAGCAGGTGATCATAGCATGCGGT
AAGGCTGTTGCTGCGAATGATATGTATGCGACAGAAACTATTGATATCTGAGCTAG
page-top