Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig76
Contig Information
Length 342 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14j10    rwhcs14j10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0174800 [Oryza sativa (japonica cultivar-group)] >gi|19881780|gb|AAM01181.1|AC113336_33 Putative S-receptor kinase [Oryza sativa (japonica cultivar-group)] >gi|31430487|gb|AAP52396.1| Protein kinase domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113638849|dbj|BAF26154.1| Os10g0174800 [Oryza sativa (japonica cultivar-group)] >gi|125574166|gb|EAZ15450.1| hypothetical protein OsJ_029659 [Oryza sativa (japonica cultivar-group)]
Score 99
Evalue 0.0097894
Total Hit Count 28
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig76
ATTTGGAGCTTCTTGGTTGCCTTGCAAGGGTTGCCGTGGAATGCCTTAACCTTGATGTGGATGAAAGACCAGCAATGACAGATGTAGCAGAGCGCCTTCT
CATGTTGAAGAGATCACGTAAGTAGTTATAGACATGACTGTATGTTTGCTGCGAGACGATTGACTTCCTTGCATGCTTGTCCCTCTGTTTTTGGGGATGT
TTTTGCTGGTTCCCCCCAGCCGTACCTTTGTTAAGTTGGTAATCTCAGCAGCTGTATCCTTGCTGCTCTGTTTGCACTCAGGCCCTGTTTTAGGGCTTTA
TTATAAAGTTGCACCATTGTGGCTTTCGTTCCAAAAAAAAAA
page-top