Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig75
Contig Information
Length 605 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14j20    whcs16n14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 203
Evalue 1.59965e-14
Total Hit Count 211
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig75
CTCTTTTTCTCATTCAATCAGTCATGAATTCAAAATCCGCTTTCCTTCTGATCGTGGTGGCAGTTAGCACCACGGCCATGGTGCACGGCCACCCTGCCGC
TAGCACTCCAGCGGCACGGTTCTGGGAGCAGGCCCTCTCCGGCACGCCGATGCCGGAGGTGCTAGCTGATTTTGTTCAGAAAGGAATGGATCTGTCACCG
CTCGTGGAGCACTACTCTGCACAGCCTAGTATCGGCATGTGCACACTCTTCAACACTATCTGCGACGCGCGCACGGTGGCGGAGACCGGCATCTTCTTCC
ACGAGGCCGAGCTACATCCGGGCAGCACCATGACCCTGTATTTCCCAGCGGAGGCGGAGACAGCCATCCTCCCGCACGACATCGCCGGCAAGGTCCCCTT
CGAGAACCTAAGCGACGTCCTCTCCACGTTCCACATCTCACCAGGCTCCGCTGAGGCTGCGCAAGTGGAGGACACCCTGCGCAAGTGTCAGCAGCCGCCA
ATCGCCGGTGAGATAAAAGCCTGCACCATGTCGCTAGAGAGCACTGTAAAGGCCGCCATGGAGATGCTCGGCACCACCATCCAGCAGGGTGGTGGTGGTG
GTGAC
page-top