Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig74
Contig Information
Length 702 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14k01    rwhcs14k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0752300 [Oryza sativa (japonica cultivar-group)] >gi|46390123|dbj|BAD15558.1| unknown protein [Oryza sativa Japonica Group] >gi|46390226|dbj|BAD15657.1| unknown protein [Oryza sativa Japonica Group] >gi|113537672|dbj|BAF10055.1| Os02g0752300 [Oryza sativa (japonica cultivar-group)]
Score 419
Evalue 1.97972e-39
Total Hit Count 24
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig74
GTGCTACAAAGTCTTGCACTTGCTCTTTCTGTCTTAAGGCTGCTTTTATGTGGACTGATCTCCATTATCAGGATGCAAGAAGCCGGCTTGGTGCATTGAA
GAAGAGCATAAAGTTTGCTAGATCGCTAGAGGCAAAGAGGCAAGGAAATGAATTCAATGCAGACAGATACTCGAAAAGAGCTGCAGAGATGGGATTCGAA
CTATCTCAACAACAGAGATCACTCTTTCTTCATACTGAAAATGCCCTTGTTCGTGAATCTGCCCAGCTCCATTCAGCTGTTGTCAAGTTAAAGGACTTGA
GAGATAACTGCAAGAAAGATCTGAAGATCTGATCATCAATTCTTCCCCAGGAAGACGAGTCCTGCATGCACGGTTGTGCTCTGGTAAACTTGTTGCCCTG
GGATGTAGTAGGATAAGCTGGATCTTTTTGAATCAAGATGTGTATGGTGTTTGGTTGTCAACTAGCAAGTTAGGGGGTTATCAAGTAGGAAATTCGGCCG
TAGTGATTACTCCTAACTTAAAGCATAGGCCAGCATCTTAGCCTCCGAAGATCAGCAGAGGAAATGCTTTTGTAAAAATCTTAGAGGGAGTTGTGAACTG
TAGGTTTGTGACGGGAGTCCTTTCAGTTGCCACGTGGATGTGAGATAGCACCATCTTGTTTCCTGCTCTCCAAGGAGCCAAACGGGAAGTGCAAAAAAAA
AA
page-top