Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig73
Contig Information
Length 454 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14k02    rwhcs14k02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0115M15.12 [Oryza sativa (indica cultivar-group)] >gi|116310356|emb|CAH67369.1| OSIGBa0128P10.3 [Oryza sativa (indica cultivar-group)]
Score 337
Evalue 2.50012e-30
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig73
AAACACGAAAAAGCTTCTGGAGGGTGAACGGGGACAACTTATAGCCCAGAAGGACATAATTGTCGTAGGCGAATCTGGACTGTTCACGCCTGACCATGTT
TCATTCGTTCAGGATGCCGGGGTCAAAGCGATTCTTGTCGGGGAGTCCCTCATCAAGCAGGAGGACCCTGGGAAAGCAATCGCTGGGCTTTTCGGCAAAG
ACATCTCACCCGTGAGTAGTGCGGTGTAAATAGGAAAAGGGGCAAGGAATCGTGAAACGCTGGGCCTCTCATATTTTGTATAGGAGAACAGAGCGATGTG
CGCTTTTGGAGAGTTTTGGTCAGCAATTTTGTTTACCTGGCCAGTATCAGTGTTCTTCCCTTGCTGCCATTTCCTGGAAGTTGTAACCGGCCTCACTGTT
CAAAGGATGCAATGCGAAGAGAGATGATCGAATAAGTTGGGTGTAAAAAAAAAA
page-top