Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig72
Contig Information
Length 748 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14k05    rwhcs14k05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_018475 [Oryza sativa (japonica cultivar-group)]
Score 785
Evalue 8.20395e-82
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig72
GCCAAAAGCATACCCGCTTCAGATCAGCAAGATGCATCTGGAAATAAGCTGCTTCTTGATATTGGTCTCTGGCTGACTCACAAGATTAAGGATCACTTCA
AGAGCAAAAAGATGGAGATGACGATCAAATACATTGATCCTACCTACATGATCCGAGCTATTCCGAGTAATGCAGCAGACAATGTCTACTGCACACTGCT
GGCTCACAGTGCCATCCATGGCGCAATGGCGGGTTACAGCTTCACTGTTGGGATGGTCAATGGCAGACATGCCTATATACCTTTCTATAGGGTGACGTCC
ACACGGAACAAGGTGAAGATCACTGACCGGATGTGGGCGAGGCTGCTGTCGTCGACCAACCAGCCAAGCTTCCTGAGCCAGAAGGACATCGATGAGGCCA
GGGAAGCCGATAGGCTGGCCAACAAGCCGCCGCTGCCGTCTGTCGCCAACCACAATGTGGCAAAAGCCTTTGACCAATCTGCATCGACTTCGTCCAACGG
CGAGATATAGTAATGCGTTGGTCTGTAACTGTGTACAGTAGCTACTTCTATCCTGCTGAGAAACATGTGCCACGCCGCCATGCCACGAAGTTTTGCTTCC
TTATATATCTCTTTGTGTAGGAGTAGTGCACGTATGGATATTGTTCAGGTGTTCTGTGAAATAAGCGGTACTATTGTGCTACTATTGCTGACAATGTTCT
TTANGACCTGTAATGAACCGTTTGTCCACTTTTANGATAAAAAAAAAA
page-top