Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig71
Contig Information
Length 1176 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15m08    rwhcs15m08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit charged multivesicular body protein 4b [Zea mays]
Score 554
Evalue 1.06242e-54
Total Hit Count 387
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig71
CCGGTCCCGCTTTCCCCTTCTTCTCCCCCGTCCGCTCCACCACCCGAGCGACTCCAGACCACGAGCCCCGCCGACGAAGCCGCCGTTGCCAGCCCCCACC
CGCGTGCAAGAGGGGAGCGCCCCACTTCCGACATTCAAGCCGATCGGAGCGCGATCCGGCGGGTCGGAGCCCAGCCATGTCGGGGGTTTTTGGCAGGGTG
TTCGGGAAGTCCAAGGAGCAGAGCCAGGCGTCCGCGCTGGCCTCCATCGACAAGCTCAGCGAGACTCTTGAAATGTTAGAAAAGAAGGAAAATTTACTAA
TGAAGAAGGCGAATCTTGAAGTTGAGAAGGCAAAGGCGTTCACCAAAGCCAAGAACAAAAAAGCTGCAATACAATGTCTGAAGAGGAAGAGATTATATGA
GCAACAGGTGGAGCAGCTTGGGAATTTCCAATTGAGGATTCATGATCAGATGATAATGCTGGAAGGTGCAAAAGCTACAACAGAGACTGTGGATGCATTG
AGAACCGGAGCATCAGCAATGAAAGCTATGCACAAATCAACAAATATTGATGATGTTGACAAAACCATGGACGAAATTAATGACAACATGGAGAACATGC
GGCAGATCCAGGATCTACTATCTGCGCCTATGGGAGCAGCAAGTGATTTCGATGAAGATGAGCTGGAAGCTGAACTTGCGGATTTGGAGGGTGAGGAGTT
GGAGGCACAGCTACTAGCACCTACCACAAGTGCTCCTATGACTGCTCCAGCGCGTGTACCTCAGCAGTCGAGTCGGCCCACTGCGCAGAGCAGTAAAACT
GAAGACGATGAGCTGGCAGCTTTACAAGCTGAGATGGCTATGTAATTAGTTTGCAGGACTTGGCGTGGTCATGTTTAGAGACCAGATTGTGCAAATATAT
TTGGGACCACGGTATTTTCATGGAGGTCTTCCTGGGAAGACGTCAGAAGTACACACAGAAACTAGATGCATCTCACCCTGATGGTCTCTTATGTATATCT
TATCATGTTACTTTTGTAATCAAACATCTAAGATGCGCTGTCGAGCGCATTATCAGCTAATAAAGGGCATCTGCCATCATTGTATATTTCTATATAAAGT
GAGTTAGTTGACCGACCACTCAACTTTTATTTCCTACTACTAGCTAGCCTGTGCGTGGAANCGGGGGCACACACAT
page-top