Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig70
Contig Information
Length 821 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14k07    rwhcs14k07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit deoxyhypusine synthase [Zea mays]
Score 1059
Evalue 1.65119e-113
Total Hit Count 446
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig70
ACGGTCAAAGGACTTAACCGGATAGGAAATCTGTTGGTGCCCAATGATAACTATTGCAAGTTTGAAAACTGGATCATGCCACTCTTTGACCAGATGCTAC
AAGAACAATCTACTGAGAATGTCTGGACACCATCAAAAGTGATTGCTCGTCTTGGCAAAGAAATAAATGATGAAAGCTCCTACCTTTACTGGGCATACAA
GAACAATATTCCTGTATACTGCCCAGCACTGACTGATGGATCACTCGGAGACATGCTGTTTTGTCATGCAGTTCGCAATCCTGGTCTTATTATCGACATT
GTACAAGATATAAGGCTGATAAATGGTGAAGCCATTCATGCAAGCCCAAGGAAGACAGGGGCCATAATTCTTGGTGGAGGCCTTCCAAAGCACCACATAT
GCAATGCAAATATGTTTCGCAATGGTGCAGATTATGCAGTCTATATCAACACAGCTCAAGAGTTTGATGGAAGCGACTCAGGAGCACATCCAGATGAAGC
AGTTTCATGGGGAAAGATCAAAGGTTCAGCAAAGCCTGTAAAGGTTCACTGTGATGCTACTATCGCTTTCCCGTTACTCGTAGCTGCAACATTTGCACGG
AGGCCTCATAGTGCAAATTCAACCAATTGAATTTCTCGCTGCTGCGAACTAAGGGCCTGAAATTTATTTTTCATTGATCTCCAACCGTTTGTCCGGGCTG
TTTGGAGGATGACATAGAAGGGTTTTCGTCAGATGCCGGCGCCACAATTACTGATTCCTTTTGCTGGATGTATACCTGAGGTTGTAATACCAATTGTATG
CTTTGTGATGAGATTGTGTAA
page-top