Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig68
Contig Information
Length 1398 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15l13    rwhcs15l13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0602700 [Oryza sativa (japonica cultivar-group)] >gi|34394917|dbj|BAC84469.1| putative receptor-like protein kinase [Oryza sativa Japonica Group] >gi|50509673|dbj|BAD31710.1| putative receptor-like protein kinase [Oryza sativa Japonica Group] >gi|113611743|dbj|BAF22121.1| Os07g0602700 [Oryza sativa (japonica cultivar-group)] >gi|215712264|dbj|BAG94391.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1149
Evalue 5.52552e-175
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig68
CCGCAGCTCAGCAGGGTCGTGATCTGAATTCATACGACAACGATACAGCGCCTGTGGATCCACAAAACCAAGGAGGAAACAGTTCATTCAATGCAATTGA
AATAGCTTCGATAACATCAGCAACAGCTATTGTTTCAGTCCTTCTTGCTCTGATTGTACTATTTATTTACACAAGAAAGTGCGCACCCTTTATGTCAGCT
CGATCATCTGGAAGAAGGGAAGTTATAATCTTCCAAGAAATCGGAGTGCCGATCACTTATGAGACTGTTGTTCGAGCTACTGGAACTTTCAACGCAAGCA
ATTGCATTGGAAGTGGGGGTTTTGGAGCCACTTACAAAGCTGAAATTTCACCTGGAGTCTTGGTAGCTATAAAGAGGCTTTCTGTTGGGAGATTGCAAGG
ATGGGAACAGTTCCATGCTGAGATCAAAACTCTTGGGAGATTAAGACATCCCAATCTTGTTACCTTGGTAGGCTACCATCTTGGTGAATCTGAAATGTTT
CTCATATATAACTACTTGCCTGGAGGAAATCTTGAGAGATTCATACAAGAGAGATCAAAGAGACCAGTAGAGTGGAAGAGGCTGCACAAGATTGCTCTGG
ACATTGCAAAAGCACTCGCTTATCTGCATGACACCTGTGTTCCTAGGATCCTTCATCGTGACGTGAAACCAAACAATATTTTGTTGGACACTAACCATAA
TGCTTACCTCTCAGACTTTGGACTGGCAAGGCTCTTGGGAAATTCGGAAACCCATGCAACCACTGGTGTTGCGGGAACTTTTGGATATGTTGCTCCAGAA
TATGCTATGACTTGCCCGTGTTTCAGATAAAGCCGATGTTTATAGCTATGGTGTTGTACTGATGGGAGCTAATATCAGACAAGAAGGCCTTGGATCCATC
ATTTTCTCCTTATGGTAATGGGTTTAACATAGTTGCCTGGGCATGCATGCTGCTCAAGCAAGGCCGTGCTCGTGATTTCTTCGTCGATGGTTTGTGGGAT
GTGGGCCCGCATGATGACTTGGTAGAGGTGTTGCATTTAGCAGTGATGTGCACCGTTGAATCGCTCTCTATACGACCAACTATGAAGCTAGTTGTTCAAC
GACTAAAGCAACTCCAGCCTCCAATACGTGAACACCGATGAGGGCGCATGATTCACATACTGAACTTGTAGAAGGTACAGATAACTGTAACTTGGGCCCC
TTGATGATTTTTCTTCTTCTAATCAATCGTTTAACTAGATTGTATCTTGTAGATCCCAGCTTTGTATAATATAGTTCTCCACTTAATTGCCAACTACTGT
ATCTGCAGATATGACAAGCAGATATAAATTAACAATCTTAGTTCTAAAGATTTGATTCACGATTGGCTGACTCCATCTTGTTGTATCGTTTACAAGAT
page-top