Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig66
Contig Information
Length 568 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14k16    rwhcs14k16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Metallothionein-like protein 1; Short=MT-1 >gi|170787|gb|AAA50846.1| metallothionein-like protein >gi|51243716|gb|AAT99562.1| metallothionein [Triticum aestivum] >gi|51243718|gb|AAT99563.1| metallothionein [Triticum turgidum subsp. durum] >gi|51243720|gb|AAT99564.1| metallothionein [Triticum turgidum subsp. durum] >gi|51243722|gb|AAT99565.1| metallothionein [Triticum aestivum] >gi|51243724|gb|AAT99566.1| metallothionein [Triticum turgidum subsp. durum]
Score 172
Evalue 5.36727e-11
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig66
CCCGATACCAAAGCCCATCTTCTTCTCCTTGAAATCTTTTTGGGTTCACAGATTTGGAGGATGTCTTGCAACTGTGGATCCGGTTGCAGCTGCGGCTCAG
ACTGCAAGTGCGGGAAGATGTACCCTGATCTGACAGAGCAGGGCAGCGCCGCCGCCCAGGTCGCCGCCGTGGTCGTGCTCGGCGTGGCTCCTGAGAACAA
GGCGGGGCAGTTCGAGGTGGCCGCCGGGCAGTCCGGCGAGGGCTGCAGCTGCGGCGACAACTGCAAGTGCAACCCCTGCAACTGTTAAGCTGCATGCACT
CGTACGTACGTACGTGTGATGGTGTGAGAGTATACTTGAATAACGAGCGTCTGATCTGATGGAGTCGAGCAAGGGTGCGTGTGCGTGTGATTTGCTTGCT
CGCTCTCCGCCTATGCTCTGCCCATGGTGTCCTTGTGTGTATGTGTGTGCGCATGTCTCCCTGTAATTGCTTCATCTATCTCCACTATGGATGGAGTGAT
GAATATGTAAGAATGAAAGATTTACCTAATTAACTAGTCCTAAATCGCTACTTCAGTTAAAAAAAAAA
page-top