Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig65
Contig Information
Length 733 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14o12    rwhcs14o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Acyl transferase [Clostridium cellulolyticum H10] >gi|219998624|gb|ACL75225.1| Acyl transferase [Clostridium cellulolyticum H10]
Score 79
Evalue 5.83896
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig65
GTGGTGGTGGTGCCGTCGAGGTCGGGGATGGTGCTCCGCGGCCTGGATGCCGCGTTCTTCCTCCCCATGCGATTCCCTTCTCCCTCGGCTTCTTCTACGC
CTGATTCGTCCTCGACCGCCTGGTATACAAGGAGCAAATGATGTTTCAATGATACAAAGGGTTGATGTTGGTTTTGGTACGTTCATAGGTTTATGCGGCA
CATATATACTGGCATAATACTTGCTGAAGCACCTCCCTAGCTTCCTTGCCTTGCTGCTCTAGCACCAGCCTCGTCGCAGTTGAGAGGTGGGATCCATATG
GCAGGGATGAAAGCCAGCTTCAATTGGCATGCAATAAGACCAAATGGCAGTTTGGACCATGAGCTTGCGGATGCTAAAGAAATTCTTAGGTACGTAGTCT
GGAATAAAAGCATTCAAGAAGTTCACTAGGCCAGAATGCTTGAAGTCGGTCTTGATGACTGTAACTCACGTTTCCTCAGCATGCTAAAATGGCTCAAGTT
ATTCATCTTTCCAATGCAGAGCAGATCGAGTGGCGTAAGGTGGTGTTGCTGTGGGACATTGCAACTGCTCCCAGATCGATTGAAGCTTCGTTTGAATGTT
TTAGTTCATCTATGCTTTTGATTATATTTCTACAGAATAATGGGGGTTATACTTATTCTCGACGGCCTTGCGGAGAGTATTCTGAATTGTATTCATCGCT
TCCAAGTACCCGTTTATATTTCTAAAAAAAAAA
page-top