Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig64
Contig Information
Length 657 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14k22    rwhcs14k22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal Pr 117 [Triticum aestivum]
Score 719
Evalue 2.8024e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig64
GCAGCCGCCGCCATGTTCGAAGCGAGGGAGGGGAGGCTCCGCGGGGAACAAGTTCCGGATGTCGCTGGGGCTGCCTGTGGCGGCGACGGTGAACTGCGCC
GACAACACGGGCGCCAAGAACCTCTACATCATCTCCGTCAAGGGCATCAAGGGCCGCCTCAACCGCCTCCCGTCCGCCTGCGTCGGCGACATGGTCATGG
CCACCGTCAAGAAGGGCAAGCCCGACCTCCGGAAGAAGGTCATGCCCGCCGTCATCATCCGCCAACGCAAGCCCTGGCGCCGCAAGGACGGCGTCTTCAT
GTACTTCGAAGACAATGCTGGAGTGATCGTGAACCCCAAGGGTGAGATGAAAGGATCTGCCATCACCGGACCTGTGGGAAAGGAGTGTGCTGACCTTTGG
CCCAGGATCGCCAGCAACGCCAATGCCATCGTTTGAGAGCCTGTTTCAAGTTGTGAGACTGCTTATATAATGCCAGTGTGGGTTGCAGCTGTTTTGCCTG
GGAAATAGTGGAACTCTGCGTTGCTCTGTTTTGTTTGGCATCTCAGTTTCTTAGTGAACAGAAGCCTGCCTGTCTGCTTAGTTTAACAACTGTAACTTCG
TTGCCAGAGAAAATGGTGAACTTTGCGTATCTCTGTTTTGGTTTGGCAAAAAAAAAA
page-top