Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig63
Contig Information
Length 998 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14l04    rwhcs14l04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0174200 [Oryza sativa (japonica cultivar-group)] >gi|27085282|gb|AAN84504.1| serine/threonine protein kinase [Oryza sativa (japonica cultivar-group)] >gi|49388976|dbj|BAD26193.1| serine/threonine protein kinase [Oryza sativa Japonica Group] >gi|113535578|dbj|BAF07961.1| Os02g0174200 [Oryza sativa (japonica cultivar-group)] >gi|125538282|gb|EAY84677.1| hypothetical protein OsI_06049 [Oryza sativa Indica Group] >gi|215715259|dbj|BAG95010.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1407
Evalue 1.02117e-153
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig63
TGATCTGGGGAGGTTGGATATGGGGGTTCCCTTTGCACAGGGAGCCTTTGGGAAGCTGTACCGGGGAACATATATTGGAGAAGATGTTGCCATTAAGCTG
CTGGAGAAGCCTGACAATGATATCGAGAGAGCACAATCGTTGGAACAGCAGTTTGTGCAAGAAGTTATGATGTTATCTACCCTAAGGCACCCAAATATAG
TAAGATTTATAGGGGCTTGCAGGAAGTCAATTGTGTGGTGCATTATTACTGAGTATGCAAAAGGTGGCTCAGTCAGGCAGTTCCTGGCAAAAAGGCAGAA
CAAGTCGGTACCTTTGAGGCTGGCTGTCAAACAAGCATTGGATGTAGCGAGGGGAATGGCGTATGTGCATGCTCTGGGATTTATCCATAGGGACCTGAAG
TCGGATAATCTTCTAATTGCAGCAGACAGATCCATTAAGATTGCTGACTTTGGAGTTGCTCGAATTGAAGTGAAAACAGAGGGGATGACACCAGAGACAG
GAACCTACCGCTGGATGGCACCGGAAATGATCCAGCACAGGCCTTATGATCATAAGGTTGATGTCTACAGCTTTGGGATTGTCTTGTGGGAGCTTATAAC
TGGCATGCTTCCTTTCACAAACATGACAGCTGTTCAGGCGGCTTTTGCTGTTGTAAATAAGGGTGCTCGTCCAGCGATCCCACATGACTGCCTGCCTTCC
CTAACCCACATCATGACGCGCTGTTGGGATGCAAACCCTGAAGTTCGCCCACCATTCACCGAGATCGTCTGCATGCTTGAGAACGCCGAGATGGAGGTCG
TGAGCCATGTCCGTAAAGCGCGCTTCCGCTGCTGCGTTGCTGAACCCATGACCACCGACTGAAACTAAAGCAGGTTAGACTATCGCAGCGGGCATTAGGG
AAGAAAACAGGTAAGGATGAAGAAAAGAGGCAATGCCAATGTGTTCATCGTTGTCAGTGCGTGGGGTCTGTGTGCCTTTACCAGTGCGCATTCTGTCT
page-top