Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig62
Contig Information
Length 1155 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15k16    rwhcs15k16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01428 [Oryza sativa Indica Group]
Score 1111
Evalue 2.66883e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig62
AGATCTCCCACGGGCCAAGGCCAGGAGCCAACAAACGCAAGGCCACCGCCGCCTCTGCGCCTCCGCAGTCGCCGTTCTGCGATCTTGCCCGCCGCCGCCC
GGAGAGATGGCGAAGGCGTTTTACGCGGTGGGTTTCTGGATCCGGGAGACCGGTCAGGCCCTCGACCGCCTCGGCTGTCGCCTCCAGGGGAACTACTTCT
TCCACGAGCAGATTTCAAGACATCGCACACTTATGAACATCTTTGACAAAGCCCCTCATGTTCACAAAGAGGCATTTGTCGCTCCAAGTGCATCCCTTAT
TGGCGATGTTGAAGTTGGGCAAGGGTCTTCAATTTGGTACGGATGCGTCTTAAGAGGTGATGCAAATAACGTTCAAGTTGGATCTGGGACCAATATACAG
GACAATTCTGTTGTGCATGTGGCAAAATCTAATCTAAGTGGAAAAGTCTTTCCAACTATCATTGGAGACAATGTCACAGTAGGGCATAGTGCTGTATTAC
AAGGATGCACTGTTGAGGATGAAGCTTTTGTTGGTATGGGAGCTACCCTGTTAGATGGTGTTGTTGTGGAAAAGCATGGGATGGTTGCTGCTGGAGCCCT
TGTAAGACAGAACACGAGGATCCCTTGTGGAGAGGTATGGGGTGGAAACCCTGCAAAATTTCTGAGGAAGCTCACAGACGAGGAGATCGCTTTTATTGCG
GAATCAGCTGCCAACTATTCCAACTTAGCCAAGGCACATGCTGTTGAGAATGCTAAATCCTTGGAAAAGATTGATTTTGAGAAAGTCCTGCGCAAAGAAA
TTTGCTCACCAGGACGATGAACACGATTCCATGCTTAGTGTCACTCGAGAGGTCCCTCCAGAGCTGGCGCCCCCCAGTCCTACTCCTGCCCAATAAACTT
TTCTTATCACCACCTTCAGTTTGCATTCTTATATCTCTATCTGTCCAGTGAGTTTGGCAGTTTACTTTTACTTCAGTAATTTTGGGTCGAGCAATGTTCT
AAAGCTGACCATGTACTTCAGTTTCTGTATTCCATATGTTCAAGATCCATGGAACAAATAGATCCATTTCGCACAAATTTATGAGTAGCATGTGCTGCGT
GCATAGTTTACTCTGGCTGAAATTGCGAGATGCATTGGAGGCAGCACATGAACTG
page-top