Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig61
Contig Information
Length 843 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15i08    rwhcs15i08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605920|gb|ACG24790.1| peroxiredoxin-5 [Zea mays]
Score 834
Evalue 2.13417e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig61
GGCTCTGAGCAGGCAGCTCCCAGCCGTGCGCCGTCTCAACTCTCAAGCGCCGCTCGCCAGCGAAACCCGATCCAAGGACAACAATACCTACTCCCAACCT
TCTGTGGCGATGGCTTCAGCACTGGCGAGGAGGGCGGGAGGTTCCCCTGCGGCGGCGCTGTGGGCCGCGGCCAGGGGGTTCGCGTCGGTGGGCTCCGACA
TCGTCTCCGCGGCGCCCGGCGTGTCGCTGCAGAAGGCGCGGTCCTGGGACGAGGGAGTCGCCACCAAGTTCTCCACCACCCCTCTCAAGGACATCTTCCA
TGGGAAGAAAGTCGTCATCTTCGGGTTGCCGGGCGCATACACAGGAGTATGTTCGCAGTCACATGTCCCTAGTTACAAGAACAACATTGATAAGTTGAAA
GCAAAAGGGATCGACTCTGTTATCTGTGTAGCTGTAAATGATCCCTATGTGCTGAATGGATGGGCAGAAAAATTACAGGCAAAAGATGCAATTGAGTTTT
ATGGCGACCTTGACGGGAGCTTCCACAAAAGCTTGGATCTGGAAATAGATCTCTCTGCTGCTTTGCTTGGCCGCCGCTCCCACAGGTGGTCAGCCTTTGT
CGACGATGGGAAGATCAAGGCTTTCAACGTTGAGAAAGCCCCTTCCGACTTCAAGGTTTCTGGTGCTGAGGTTATCTTGGATCAAATCTGAGCTAATCGG
TGCTCTGTTTTGCTTTTGTGAAGCGAATAAGTGACAGCTCGAGAATCTGTGTGAAGATGTTGCTGTCTGTCGTGCTAGTTCCAGAACAGTCATTTTGCTG
CTGCAAATCTTTCTTTCTTTTGTTCCAGAACAGTCATCGAATT
page-top