Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig60
Contig Information
Length 638 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14l15    rwhcs14l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21448 [Oryza sativa Indica Group]
Score 161
Evalue 1.3426e-09
Total Hit Count 158
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig60
CAGCAGCAGCCTCCTAGCNTGTCGGGACCCGTGAACACCAACAAACCTGCTAGTGGAGACCAGGCACATCAGATGAATAACGGAGCCATGAAGGGTGCCG
CTCAAACGGGTACGACAGGGCCCAGCAATCTGATCAACAGTGGAGCCGGCATCGTCCAACGATGCAGCAGTTTCAAGTCGGTGAGCAGCAACCCAGCTGC
TGGCGTGGCCGCTTCCGGCAACACAGCGAGTCCTAAAGGTAGCGGAATCCATGCACGAGGAGGACGAGCTNGACCATCTCATCAGCAGNGAACTCGCAGA
GAGCGGTCTGTTCATGGGGGAGCAGCAGGGTGGCGGCGCGTNCTNGTGGGACATGNGACGGAGGGACCGCTAAATCTCTCAACNTAAAGTTTCTCTCTAC
TCCNTAAGTCGTGCTTGATGTAAAATCGCCGCAAGTTATTCGGAGTTTTTCTTCTTTTCTGTTAAGCTTTCGTGTCGCTGACCGGAACAGTTTCTGATGA
TCATGCACNGATTGNACCTTCAGTTGTGTGAGTGTGAGGGATCTGGCTATGGCTGGGAAAGTTGTTGAAGAGTAGTACACTGCAAGCCCAGNGATATCAA
GCAAGGAATGTCATGCTGCNGTGTTGTCATTGTGCTGC
page-top