Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig59
Contig Information
Length 781 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14l23    rwhcs14l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_02792 [Oryza sativa Indica Group]
Score 802
Evalue 1.80904e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig59
GCCGAAAGAAGATATTATTTGCTCCTGTGATAGTGATGGGGGAAGTCCGCAGTTGGAGCATTAACAATGGTAGCTGCCTGACCTGTGTCAAGGTTTTTAA
GGGAGGTGCCACTCAGATGAGATTTCAACCCCGCAAAGGAAAATATCTAGCAGCTGCATCAGAGAAGGCTATCTACATACTTGATGGGGAGACACAGCAT
GCTTGTAGAAGCCCTTTACAGGGTCATGCAAAGGACATTCAGTCAGTTTGTTGGGACTCTGCGGGTGACTATCTTGCTTCTGTTAGTGAAGATGCTGTCA
GAATATGGTCATTTACTTCTGGGCAGGACGGTGAATTTGTGAATGAGTTGAACTGCAGTGGGAACAAGTTTCAAACATGTGTTTTCCATCCAGCTCACCC
TTCTTTGCTAGTCATTGGTTGTTACGAGTCCTTGGAACTTTGGGACATCAGGGAGAAGAATGCCATGACCTTCAACAATGCTCATGACGGTTTAATTGCA
GCCCTAGCAGCATCGAGCGCAACAGGCAAGGTTGCCTCAGTTAGTCATGACAGGCTTGTCAAGCTCTGGAAATGACTTGTAAAATAGTGACTGTTGTTTG
TCGACTTTTACATTCTGTTGCTAGATTTTATAGAGAACAGGATGGTTCAGATAACCACATGACAAGGAGGTACTAGCTAACAAAAGGCAGGTTTGCGATT
TGTGGTTGTCTTAGTTGTATCTTGTATGCTGCTTCTCAAGTTTGTAACTCGTTATAGAATGGGCTGTTTGCCTGCTGTTAC
page-top