Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig58
Contig Information
Length 893 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14m03    rwhcs14m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_009268 [Oryza sativa (japonica cultivar-group)]
Score 970
Evalue 3.99887e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig58
CGTCTTCGACCCTCGATTGAGAAAAGTGATTGCAAATACACAAGATATTTCGGTCGCTATGTTGCTCGGGAGGCTATAATGGATGAGGAATACTGGACCT
TATAGATCGCCGCATGGTTGAGAGCAGAAGATCACTATGAAGATCAGTCAGGCGATCGCTATGTTGAAAGCTTTAAAAGAAAGTTTGCATCACAGGAATT
TCATGCTTTAAAGAAGCGATGTGGCAGGCAGGTTGGAGAGAAGTATACCTGTTTTGTTGCGGTAAAGAATGATGACGTCACACGAACTGTGGTGAATAGT
GTTGTTGGTACAGTAGATCTATGTGTTAGGCATCCTCTACATGGGGAGACATACCCTGCGGAGCCTGGAAACACACCATTTTACTCTAGAATCTATCAGC
CAGATCAGCCAAAATTTGGATATTTAACCAATGTTTGTGTTGCTAAGTATGCACGGCGTCAAGGGATTGCCAGCAACATGTTGTTATTGGCCATCGATGC
TGCAAGACTCGATGGTGCTGAAAGCATTTATATTCATGTACATAAGGATAACTTGCCAGCTCGGAGGCTCTATGATCATGTAGGATTCAAGATGGTTGAC
ATGGATGGTGCTCGCCAGTCATCAGATCTGTGCTTACTCTCCTTCAATTCTATGCACTAGGCTAGTTAACAGGGGATTTATTCCCATATCCTTTGTGCAG
GTGAAAGTATGCCATCAGTCCTCTTGATTTAGAAAAAGCAGGACGGTGTCGGTGAATATGTTTTACCATCTTGCACATGATAAAAGCTTGTAAAGTTCAA
AATCCTTGGAATCGTCTACATGGGACGACAGTACCAGTGTCCAGAATGCTGTTGATGTGTGTGTGGGCTTTTCATCTGAATGCTTCGGTTTTT
page-top