Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig54
Contig Information
Length 607 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15j18    rwhcs15j18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32275 [Oryza sativa Indica Group]
Score 243
Evalue 3.72966e-19
Total Hit Count 160
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig54
CTCTATCGTTGACCCAAGATGTCGTTCTGGTGCTATAGTAACTAGGGATCTGCCTTCTCTAGTAACAGCTTTGGTTAGTCTGAGATCTGACAATTTTCAT
TATAAGGAAAACACAATACTGGGTCATGGTCTACTTGATGGCCTCTCACATGCCACAACCTTGCAGTTGCATGCACCATTACCTGAGCTCACACTCGAGA
GAGGCCTGCGGACATGCCCGGTGTTCAGCAGCCTGACAAGTCTGGTATTGGGTGATTGGTGCATGGCTGCTGACTTCTACCCGCTGCGTCGCATTCTACA
TCGCTCGCCCAAGCCGAAGGAGCTAAGTTTTAAGCTCGAAATGGAGGAATGTAGAAAATGTAAGGAATTGGAATCTTCCAAAACATAAACTAGTTTAGTG
TTCAGGAGACATGATGGATTATGGTTGCTGGGTATTCTAGTTCTTCCAAAACGTTATATATCTAGTTGTGTTCTAGCCAACTATTGCATTGTTTTTTCCT
TATCTGTATGTATGATGAGATCAGAGGAGCCGATAAAAGTGTCGTTAGTGAAACTACCTTAATGTTGACACTATGGCAGGAATGTACCGCCATCTTCAAA
AAAAAAA
page-top