Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig53
Contig Information
Length 612 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14m13    rwhcs14m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31739 [Oryza sativa Indica Group]
Score 286
Evalue 3.90269e-24
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig53
CCAAGCTGAACTTGCAGCACGCATTAAGGCCAAATACTTCTCTAATAAGGCTTCTGACGGAGGAAAAATCTTTGAAGAAGAAACTATTGTTGAAGGCGAA
ACCATCCATTCAAGCAGGTGGCCATGCACAAGTTCGTATGCGAACCCGGCAAATTTTCTCCGAGAGAAGAACAACCATGAAAGGAGGGATTCTCCATCAG
CAGCAGATTCCTCTGCGAAGAACGATTCTCCATCTGTGGTAGCTGAAGCCTCGCCAAAAAGTAATGCAGGTGTTCCGGCAACAGAAAACAATCTAACACC
TGCCAAGAGACAGGTATCCAAGGAGACCTGATGGGATGACAGTAGGCTGGTGGGTCGTTGTATGTTCTCAAGTCCGAAGACTACAACAACCCGAAGCATG
CAAGTATCAGGAAATAAAAATCCGTCCAGCAGATGTATGTAGGCGATGCTTGATTCATTTCGTCGAACCGGTTTCAGCATCTGTTGGGAACAATTTTTTG
TCTTAAGTCTCAAGGTATATGCTACCTGAAGTTTTTTTTTTAAACTGCCTTACTTGTTTGTAGGCGATGCTACATTCATTTCATTGAATCTGTTTCAGTA
TTAAAAAAAAAA
page-top