Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig52
Contig Information
Length 743 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14m23    rwhcs14m23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calmodulin [Zea mays] >gi|20186|emb|CAA46150.1| calmodulin [Oryza sativa] >gi|3336950|emb|CAA74307.1| calmodulin [Zea mays] >gi|4103961|gb|AAD10246.1| calmodulin [Phaseolus vulgaris] >gi|117670150|gb|ABK56718.1| unknown [Hordeum vulgare] >gi|194706732|gb|ACF87450.1| unknown [Zea mays] >gi|195605834|gb|ACG24747.1| calmodulin [Zea mays] >gi|195611022|gb|ACG27341.1| calmodulin [Zea mays]
Score 761
Evalue 4.95787e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig52
GTTTATTCCCCTCCGGCGCAGCCGCCCCCGTGTCCTGTGCGCACCTTCTCGAAGCCTCCTCCCTCCCTCATGGCGGACCAGCTGACCGACGAGCAGATCG
CCGAGTTCAAGGAGGCCTTCAGCCTCTTCGACAAGGATGGCGACGGTTGCATCACCACCAAGGAGCTCGGAACCGTGATGCGGTCCCTCGGGCAGAACCC
CACGGAGGCGGAGCTGCAGGACATGATCAACGAGGTTGACGCGGACGGCAACGGCACCATCGACTTCCCGGAGTTCCTGAACCTGATGGCGAGGAAGATG
AAGGACACTGACTCGGAGGAGGAGCTCAAGGAGGCGTTCCGCGTGTTTGACAAGGACCAGAACGGCTTCATCTCGGCGGCGGAGCTGCGCCACGTGATGA
CCAACCTCGGGGAGAAGCTGACGGACGAGGAGGTGGACGAGATGATCCGGGAGGCGGACGTGGACGGCGACGGCCAGATCAACTACGAGGAGTTCGTCAA
GGTCATGATGGCCAAGTGAGGTGGCGGGACAGGGGGTGTCCTCCCACGAAATAAGCTTAAAATTTGCTCTCAAGTGGATTGGAATGGAATGCCAGACAGA
CTCGCAAGGTTGTATTTTGTGCTATGTTTTTTAAGTACTGTTGCCTGTTGGGTAGCTGGTCGGGTTATCTTGTAGCGGTGTAGTCGTGGGGAGCAGCATC
GGATTTACCTGGTTTCTAGTCTTATCATGGAATTTAGGGGCTT
page-top