Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig51
Contig Information
Length 1080 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs14m24    rwhcs14m24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0802500 [Oryza sativa (japonica cultivar-group)] >gi|29150372|gb|AAO72381.1| putative AAA-type ATPase [Oryza sativa (japonica cultivar-group)] >gi|108711608|gb|ABF99403.1| ATPase 2, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550072|dbj|BAF13515.1| Os03g0802500 [Oryza sativa (japonica cultivar-group)] >gi|215697921|dbj|BAG92114.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737759|dbj|BAG96889.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1141
Evalue 8.04118e-123
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig51
GTCGCCGCCAGGGCCGCGCCGTCATGGTCCAGAACCGCCGCCGCAAGCTCTTCACCAACATCTCCTCCCACCAGTTCAGCGACGGCGGCTACGCCCGCTC
CGCCTGGACGCACGTGCCCTTCCAGCACCCCAAGACGTTCGCCACGCTCGCCATGGACCCGGCCAGCAAGAAGGAGGTCATCGACGACCTCGACGCCTTC
AAGGCCGGCAAGGAGTGGTACGAGCGCGTCGGCAAGGCGTGGAAGCGCGGCTACCTGCTGCACGGCCCGCCCGGGACGGGCAAGTCGGCCATGATCGCCG
CCATGGCCAACCACCTGGACTACGACGTGTACGACATCGAGCTCACTTCCGTGCACTCCAACACGGACCTCCGCAAGCTCTTCATCGGCACCACCAGCAA
GTCCATCATCGTGATCGAGGACATCGACTGCTCCCTCGACCTCACCGGCGCGCGCCCCAAGAAGAAGGACGCTGCCCCAGAGGACGAGGACAAGGCCAGC
AAGGGCGACAAGAAGGGCGCGGCGGACGCGAGCAGCAAGGTGACGCTGTCGGGCCTGCTCAACTTCATCGACGGGCTGTGGTCGGCGTGCGGCGGCGAGC
GGGTCATCGTGTTCACCACCAACCACCTGGAGAAGCTGGACCCGGCGCTCATCCGGAGGGGCCGCATGGACAAGCACATCGAGATGTCCTACTGCCGCGG
GCCGGCGTTCGAGTTCCTCGCCAAGGCCTACCTCGGTGTCGACGAGCACGAGCTGTTCGGCACCGTGGGCGCGCTGCTCCGGGAGGTGGACATGACGCCG
GCGGACGTAGCCGAGAACCTGACGCCCAAGAGCGGGGACGACGACGCGGACTCGTGCCTCAGGGGGCTGGTGGCGGCGCTGGAGAAGGCCAGGGAGGACA
AGGCCAGCGGCGGCGGCCAGGAGAAGCAGCCGGAGGAAGAAGACGGGGGAGTGGTTGCCGCCGTTGACAAGGAGTGATCGATGGAGCGAGTGAGTCAGAG
TAGCTCAGGATCAGAATATCATGATGTCAGACACATTTTCTCTATTTGTTATTGGAGATGACGTTTATTTCTAGCAAGTA
page-top