Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig669
Contig Information
Length 657 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc10k06    whsc10k17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17455 [Oryza sativa Indica Group]
Score 80
Evalue 3.49796
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig669
CATCCGAGTCCGAGGAGGAGGAGGTTCCTAAGAAGACTGCAAAGCCTGTCAAACACGAGTCTTCAGATGATAGCAGCGACGATTCCTCCTCTGACGAGGA
ACCTGCAAAGAAGCCTTCTGCTAAACCTGTGACCCCAGCTGCCAGCAACGGCTCAAAGAAAGGCAAGCCTGAGAGCAGCTCTTCTAGTTCTGAGGATGAG
TCCGATGATGACGAGAAACCTGCTGCTCTGGTAAAGAAAACACCAGCCATCGAATCTGACAGCTCCGAAAGTGACTCAGATGATAGCTCAGATGAGGATG
TTCCTGCCAAGACTCCTGCTGCTGCTGCCAAGAAGGTAGATTCTTCAGACAGTTCTGAGTCGGAGAGTGAATCTGAGGATGAGGAGAAATCAAAGAAAGC
CGCACAGGCCACCAAGATAGCTCCTGCAGCTGCTAAAAGAAAGGAGGAGCCCAGTGATTCCTCAGACAGTGATGAGAGTGATGAAGAGCCTCCCCAGAAA
AAGCTGAAGGATGCTGCGAAGGTTACTCCTAAGTCTGCCAAAAAGGACAGCACCAGTGATGATGACAGTTCTGATGAAAGCTCTGATGATGAGCCTAAAA
AGAAAGTTACAACTGCCACAAAATCACAGAAGGAAGAGCCTAAAACTCCTGCTAGCA
page-top