Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHC_all.Contig665
Contig Information
Length 559 bp
Tissue Shoot grown with cold treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsc1c13    rwhsc1c13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11369 [Oryza sativa Indica Group]
Score 188
Evalue 7.00622e-13
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHC_all.Contig665
CAGTAATGGACGAGGGTTTCTTTGGACAGGGCAATGGAATTGGAGGCAATGGCGACAGTATGTTCAGTGATGTGAGTAACATGATGCAGCAGCAGCAAGC
ACAACAGCCACAGCAGCAGCAGCAGCAGCAGCAGCAGGCCCCGGCGCAGCAGCAGTTCTTCATCGGTGACGACGCGCAGGCGCAGTTCGGCAACCAGATG
GGCAGCATCTCCGGCGCATCGGATTTCAGGTTCGGCTCTGGCTTCAACATGTCTGGCACCGTCGACTACCCGCAGAAGAACGACGGCCCCAACTGGTACT
ACTGAATGAAGAATAAACTCCTAGGGTCATAAGCTTTCTTCGTGGCAAAACCAACCTTGTGTTTCCATGGGGAAGTGTCGTCGTCGTCCTCCTAAGAAGT
GGGTAATTCTATAGGTCTTCTCTTAATTTTCATATAGGTTTTGCAGTAGTTGCAAATAGGCTGGAACTTGGAACTGGTTATATACCATGTATGTCCATCC
AGCTGGTGAACCTCTTCTCTTATGGAAAACTTAATTTTATTCCTAGTTGAAAAAAAAAA
page-top