Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig48
Contig Information
Length 898 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs15j10    rwhcs15j10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit p34cdc2 [Triticum aestivum]
Score 782
Evalue 2.53769e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig48
TGCAGGATTCGGCACGAGGAAGCCCCAGAACCTGGCTGATAGATCGCCGCACCAATTCGTTGAAGCTTGCTGACTTCGGATTGGCCAGGGCGTTCGGCAT
TCCTGTCCGGACATTTACTCACGAGGTGGTAACATTATGGTACAGAGCACCAGAAATTCTTCTGGGTGTGAGGCAGTATTCTACCCCTGTTGATGTGTGG
TCGGTTGGTTGCATTTTTGCCGAAATGGTGAATCAGAAACCTCTATTTCCTGGTGATTCTGAGATTGATGAACTCTTCAAGATTTTCAGAATTATGGGCA
CTCCTAATGAAGAAACCTGGCCAGGTGTTTCTTCGTTACCTGACTACAAATCAGCTTTCCCCAAGTGGCCATCCGTGGATCTCGCAACTGTGGTTCCAAC
ACTTGAACCTTTGGGACTTGATCTTCTCTCTAAAATGCTCTGCTTAGATCCAACCAGGAGAATCAATGCCCGAACTGCCCTCGAGCACGAGTACTTCAAG
GATCTGGACGTGTCCTCGTAGATCATGTCCCCTGCTCCTCTGTAAATTAAGATTGCGTCGGTTGCTCGACAGCTTCCTGAATCCTCCCGGACTGTGTGCT
CCTTTCTCTCCTATTCTTTCTGACTCTGGCTGTGTAGAGAGAAATGAGAACGGAAACGCCTCCTGATCCACCCTTCCGTGTAGACCAAGCAAATTGAAAA
GATCCTGATGCTCTGGGAGCTCTGCATTGTGATTTCACCCGTATTTATATGGACATCGACGCCGGCACCAGACTTGTTCATGTACGATGAATTTTGGAGT
AGTAGCAGATAGTCAAGGGGCTGCAGTGTTTCATGAACTACCAACTGATGTGACAATGTTTGGTAGTGTACTACTACTTGTACTTGGAAACATCATAT
page-top